Overview
The rchime() function allows you to detect and remove
chimeric sequences using the dataset as it’s own reference (de novo).
The denovo approach is our preferred method for removing chimeras.
rchime() can be used with strollur
objects or data.frames as inputs. Let’s look at examples of both
data types using sequence data from mothur’s MiSeq_SOP example
analysis.
Creating strollur objects
fasta_data <- readRDS(rchime_example("miseq_fasta.rds"))
abundance_data <- readRDS(rchime_example("miseq_abundance.rds"))
strollur <- strollur::new_dataset("rchime de novo example")
strollur::add(strollur, table = fasta_data, type = "sequence")
#> Added 6084 sequences.
strollur::assign(strollur, table = abundance_data, type = "sequence_abundance")
#> Assigned 6084 sequence abundances.
strollur
#> rchime de novo example:
#>
#> starts ends nbases ambigs polymers numns numseqs
#> Minimum: 1 249 249 0 3 0 1.00
#> 2.5%-tile: 1 252 252 0 4 0 3217.35
#> 25%-tile: 1 252 252 0 4 0 32164.50
#> Median: 1 253 253 0 4 0 64328.00
#> 75%-tile: 1 253 253 0 5 0 96491.50
#> 97.5%-tile: 1 254 254 0 6 0 125438.65
#> Maximum: 1 256 256 0 8 0 128655.00
#> Mean: 1 252 252 0 4 0 64328.00
#>
#> Number of unique seqs: 6084
#> Total number of seqs: 128655
#>
#> Total number of samples: 20Loading data.frames
df <- readRDS(rchime_example("miseq_data_frame_by_sample.rds"))
str(df)
#> 'data.frame': 11039 obs. of 4 variables:
#> $ sequence_name: chr "M00967_43_000000000-A3JHG_1_1101_10133_8460" "M00967_43_000000000-A3JHG_1_1101_10133_8460" "M00967_43_000000000-A3JHG_1_1101_10133_8460" "M00967_43_000000000-A3JHG_1_1101_10133_8460" ...
#> $ sequence : chr "TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGCCATGCAAGTCAGAAGTGAAAACCCGGGGCTCAACCCTGGGAGTGCTTTTGAAACT"| __truncated__ "TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGCCATGCAAGTCAGAAGTGAAAACCCGGGGCTCAACCCTGGGAGTGCTTTTGAAACT"| __truncated__ "TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGCCATGCAAGTCAGAAGTGAAAACCCGGGGCTCAACCCTGGGAGTGCTTTTGAAACT"| __truncated__ "TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGCCATGCAAGTCAGAAGTGAAAACCCGGGGCTCAACCCTGGGAGTGCTTTTGAAACT"| __truncated__ ...
#> $ sample : chr "F3D2" "F3D146" "F3D149" "F3D150" ...
#> $ abundance : int 222 1 1 1 127 17 32 13 95 86 ...Removing chimeras
When removing chimeras using the de novo method, the potential parents are chosen from more abundant sequences in your dataset.
Before we remove the chimeras let’s discuss the
dereplicate parameter. When dereplicate=FALSE,
if a sequence is flagged as chimeric in one sample, it is removed from
all samples. Our experience suggests that this is a bit aggressive since
we’ve seen rare sequences get flagged as chimeric when they’re the most
abundant sequence in another sample. For a more conservative approach,
we recommend using the default dereplicate=TRUE which will
only remove sequences from the samples in which they are flagged as
chimeric. Let’s use the de novo method to remove the chimeras.
rchime(strollur)
#> ℹ The de novo method runs with a single processor.
#> → rchime removed `10453` chimeras from your dataset.
#> → It took `8.45336937904358` seconds to detect and remove the chimeras.
strollur
#> rchime de novo example:
#>
#> starts ends nbases ambigs polymers numns numseqs
#> Minimum: 1 249 249 0 3 0 1.00
#> 2.5%-tile: 1 252 252 0 4 0 2956.03
#> 25%-tile: 1 252 252 0 4 0 29551.25
#> Median: 1 253 253 0 4 0 59101.50
#> 75%-tile: 1 253 253 0 5 0 88651.75
#> 97.5%-tile: 1 254 254 0 6 0 115246.97
#> Maximum: 1 256 256 0 8 0 118202.00
#> Mean: 1 252 252 0 4 0 59101.50
#>
#> scrap_summary:
#> type trash_code unique total
#> 1 sequence rchime_chimeras 3588 10453
#>
#> Number of unique seqs: 2496
#> Total number of seqs: 118202
#>
#> Total number of samples: 20
#> Total number of custom reports: 1
data <- rchime(df)
#> ℹ The de novo method runs with a single processor.
#> → rchime removed `10453` chimeras from your dataset.
#> → It took `8.4896194934845` seconds to detect and remove the chimeras.
data
#> starts ends nbases ambigs polymers numns numseqs
#> Minimum: 1 249 249 0 3 0 1.00
#> 2.5%-tile: 1 252 252 0 4 0 2956.03
#> 25%-tile: 1 252 252 0 4 0 29551.25
#> Median: 1 253 253 0 4 0 59101.50
#> 75%-tile: 1 253 253 0 5 0 88651.75
#> 97.5%-tile: 1 254 254 0 6 0 115246.97
#> Maximum: 1 256 256 0 8 0 118202.00
#> Mean: 1 252 252 0 4 0 59101.50
#>
#> scrap_summary:
#> type trash_code unique total
#> 1 sequence rchime_chimeras 3588 10453
#>
#> Number of unique seqs: 2496
#> Total number of seqs: 118202
#>
#> Total number of samples: 20
#> Total number of custom reports: 1Results
The rchime() function returns a strollur
object. Let’s take a closer look at the chimera_report
generated by rchime(). The chimera_report
is a data.frame with a row for each sequence in your dataset. Let’s take
a look at the first 5 chimeric sequences in the report:
chimera_report <- strollur::report(data, type = "chimera_report")
chimera_report[chimera_report$Chimeric_Status == "Y", ] |> head(n = 5)
#> Score Query
#> 66 0.3805621 M00967_43_000000000-A3JHG_1_1106_11629_14238
#> 70 0.5261480 M00967_43_000000000-A3JHG_1_1103_26580_14708
#> 80 0.5580357 M00967_43_000000000-A3JHG_1_2101_21700_24164
#> 89 0.3348214 M00967_43_000000000-A3JHG_1_1112_23980_19089
#> 91 0.6377551 M00967_43_000000000-A3JHG_1_2110_20944_24019
#> ParentA
#> 66 M00967_43_000000000-A3JHG_1_1107_15750_18592
#> 70 M00967_43_000000000-A3JHG_1_2110_12856_16229
#> 80 M00967_43_000000000-A3JHG_1_1113_11294_24024
#> 89 M00967_43_000000000-A3JHG_1_1107_15750_18592
#> 91 M00967_43_000000000-A3JHG_1_2101_22400_13416
#> ParentB
#> 66 M00967_43_000000000-A3JHG_1_2101_22400_13416
#> 70 M00967_43_000000000-A3JHG_1_1107_15750_18592
#> 80 M00967_43_000000000-A3JHG_1_2110_12856_16229
#> 89 M00967_43_000000000-A3JHG_1_1109_25348_18015
#> 91 M00967_43_000000000-A3JHG_1_1112_6862_18037
#> Top_Parent QM QA QB
#> 66 M00967_43_000000000-A3JHG_1_1107_15750_18592 99.60317 98.01587 94.44444
#> 70 M00967_43_000000000-A3JHG_1_2110_12856_16229 100.00000 97.61905 95.63492
#> 80 M00967_43_000000000-A3JHG_1_1113_11294_24024 100.00000 98.01587 94.44444
#> 89 M00967_43_000000000-A3JHG_1_1107_15750_18592 100.00000 98.80952 94.44444
#> 91 M00967_43_000000000-A3JHG_1_2101_22400_13416 100.00000 98.01587 93.65079
#> QAB QT LY LN LA RY RN RA Div Chimeric_Status
#> 66 93.25397 98.01587 13 0 0 4 0 1 1.587302 Y
#> 70 93.25397 97.61905 11 0 0 6 0 0 2.380952 Y
#> 80 92.46032 98.01587 14 0 0 5 0 0 1.984127 Y
#> 89 93.25397 98.80952 14 0 0 3 0 0 1.190476 Y
#> 91 91.66667 98.01587 16 0 0 5 0 0 1.984127 Y